What will be the nucleotide sequence of mRNA molecule

Which of the following nuclear pre-mRNA nucleotide sequencespotentially contains an intron?After the intron has been spliced out, what will be the nucleotidesequence of mRNA molecule (without the intron)?NOTE: The consensus sequence for an intron is-5’GU…….YNCURAY……..AG3’(Y= Pyrimidine; R=Purine)
(a)5′–UGACCAUGGCGCUAACACUGCCAAUUGGCAAUACUGACCUGAUAGCAUCAGCCAA–3′(b)5′–UAGUCUCAUCUGUCCAUUGACUUCGAAACUGAAUCGUAACUCCUACGUCUAUGGA–3′(c)5′–UAGCUGUUUGUCAUGACUGACUGGUCACUAUCGUACUAACCUGUCAUGCAAUGUC–3′(d)5′–UAGCAGUUCUGUCGCCUCGUGGUGCUGCUGGCCCUUCGUCGCUCGGGCUUAGCUA–3′(e)5′–UAGGUUCGCAUUGACGUACUUCUGAGACUACUAACUACUAACGCAUCGAGUCUCA—-3’